Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 118998 |
Name | oriT_Dog025|unnamed2 |
Organism | Staphylococcus aureus strain Dog025 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP120164 (996..1184 [+], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_Dog025|unnamed2
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 19430 | GenBank | NZ_CP120164 |
Plasmid name | Dog025|unnamed2 | Incompatibility group | - |
Plasmid size | 3245 bp | Coordinate of oriT [Strand] | 996..1184 [+] |
Host baterium | Staphylococcus aureus strain Dog025 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |