Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 118937 |
Name | oriT_pSAP012A |
Organism | Staphylococcus aureus strain SBR096-6 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JAULAS010000013 (20726..20914 [-], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) 71..76, 88..93 (AAAAGC..GCTTTT) 64..70, 77..83 (GTGTCAC..GTGACAC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pSAP012A
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 19369 | GenBank | NZ_JAULAS010000013 |
Plasmid name | pSAP012A | Incompatibility group | - |
Plasmid size | 22984 bp | Coordinate of oriT [Strand] | 20726..20914 [-] |
Host baterium | Staphylococcus aureus strain SBR096-6 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIIA21 |