Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118805
Name   oriT_p35_D in_silico
Organism   Klebsiella aerogenes strain 035
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP050071 (12342..12400 [+], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_p35_D
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19237 GenBank   NZ_CP050071
Plasmid name   p35_D Incompatibility group   -
Plasmid size   13466 bp Coordinate of oriT [Strand]   12342..12400 [+]
Host baterium   Klebsiella aerogenes strain 035

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -