Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118797 |
| Name | oriT_pWP3-W18-ESBL-06_6  |
| Organism | Raoultella ornithinolytica strain WP3-W18-ESBL-06 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP021989 (48062..48110 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pWP3-W18-ESBL-06_6
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19229 | GenBank | NZ_AP021989 |
| Plasmid name | pWP3-W18-ESBL-06_6 | Incompatibility group | - |
| Plasmid size | 53995 bp | Coordinate of oriT [Strand] | 48062..48110 [-] |
| Host baterium | Raoultella ornithinolytica strain WP3-W18-ESBL-06 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |