Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118784
Name   oriT_pLH53-b-1-D in_silico
Organism   Klebsiella variicola strain LH53-b-1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JANAEY010000006 (6429..6588 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_pLH53-b-1-D
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19216 GenBank   NZ_JANAEY010000006
Plasmid name   pLH53-b-1-D Incompatibility group   IncQ1
Plasmid size   9306 bp Coordinate of oriT [Strand]   6429..6588 [-]
Host baterium   Klebsiella variicola strain LH53-b-1

Cargo genes


Drug resistance gene   sul2, aph(3'')-Ib, aph(6)-Id, dfrA1
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -