Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118779 |
| Name | oriT_p3B9067  |
| Organism | Klebsiella quasipneumoniae strain B9067 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP070443 (4580..4631 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_p3B9067
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19211 | GenBank | NZ_CP070443 |
| Plasmid name | p3B9067 | Incompatibility group | ColRNAI |
| Plasmid size | 4991 bp | Coordinate of oriT [Strand] | 4580..4631 [-] |
| Host baterium | Klebsiella quasipneumoniae strain B9067 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |