Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118773
Name   oriT_p1B2663 in_silico
Organism   Klebsiella quasipneumoniae strain B2663
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP070421 (96095..96142 [+], 48 nt)
oriT length   48 nt
IRs (inverted repeats)      6..12, 15..21  (CAAAATT..AATTTTG)
Location of nic site      31..32
Conserved sequence flanking the
  nic site  
 
 GGTGTGGTGA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 48 nt

>oriT_p1B2663
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19205 GenBank   NZ_CP070421
Plasmid name   p1B2663 Incompatibility group   IncFIB
Plasmid size   134892 bp Coordinate of oriT [Strand]   96095..96142 [+]
Host baterium   Klebsiella quasipneumoniae strain B2663

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsH, arsR, arsB, arsC, fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, ncrA, ncrB, ncrC, nirD
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIE9