Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118768
Name   oriT_p3B6885 in_silico
Organism   Klebsiella quasipneumoniae strain B6885
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP072471 (4579..4630 [-], 52 nt)
oriT length   52 nt
IRs (inverted repeats)      7..14, 17..24  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 52 nt

>oriT_p3B6885
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19200 GenBank   NZ_CP072471
Plasmid name   p3B6885 Incompatibility group   ColRNAI
Plasmid size   4991 bp Coordinate of oriT [Strand]   4579..4630 [-]
Host baterium   Klebsiella quasipneumoniae strain B6885

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -