Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118768 |
| Name | oriT_p3B6885  |
| Organism | Klebsiella quasipneumoniae strain B6885 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP072471 (4579..4630 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_p3B6885
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19200 | GenBank | NZ_CP072471 |
| Plasmid name | p3B6885 | Incompatibility group | ColRNAI |
| Plasmid size | 4991 bp | Coordinate of oriT [Strand] | 4579..4630 [-] |
| Host baterium | Klebsiella quasipneumoniae strain B6885 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |