Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118744 |
| Name | oriT_p1B25110  |
| Organism | Klebsiella quasipneumoniae strain B25110 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP070455 (96095..96142 [+], 48 nt) |
| oriT length | 48 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | 31..32 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 48 nt
>oriT_p1B25110
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19176 | GenBank | NZ_CP070455 |
| Plasmid name | p1B25110 | Incompatibility group | IncFIB |
| Plasmid size | 134891 bp | Coordinate of oriT [Strand] | 96095..96142 [+] |
| Host baterium | Klebsiella quasipneumoniae strain B25110 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsH, arsR, arsB, arsC, fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, ncrA, ncrB, ncrC, nirD |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |