Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118729
Name   oriT_pWP3-W18-CRE-02_7 in_silico
Organism   Klebsiella quasipneumoniae strain WP3-W18-CRE-02
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP021957 (3859..3908 [-], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      5..12, 15..22  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_pWP3-W18-CRE-02_7
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19161 GenBank   NZ_AP021957
Plasmid name   pWP3-W18-CRE-02_7 Incompatibility group   Col440I
Plasmid size   8604 bp Coordinate of oriT [Strand]   3859..3908 [-]
Host baterium   Klebsiella quasipneumoniae strain WP3-W18-CRE-02

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -