Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118729 |
| Name | oriT_pWP3-W18-CRE-02_7  |
| Organism | Klebsiella quasipneumoniae strain WP3-W18-CRE-02 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP021957 (3859..3908 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pWP3-W18-CRE-02_7
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTAAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19161 | GenBank | NZ_AP021957 |
| Plasmid name | pWP3-W18-CRE-02_7 | Incompatibility group | Col440I |
| Plasmid size | 8604 bp | Coordinate of oriT [Strand] | 3859..3908 [-] |
| Host baterium | Klebsiella quasipneumoniae strain WP3-W18-CRE-02 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |