Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118625 |
| Name | oriT_plamid_3.1  |
| Organism | Klebsiella grimontii strain SS141 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP044530 (1..49 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_plamid_3.1
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 19058 | GenBank | NZ_CP044530 |
| Plasmid name | plamid_3.1 | Incompatibility group | - |
| Plasmid size | 1491 bp | Coordinate of oriT [Strand] | 1..49 [-] |
| Host baterium | Klebsiella grimontii strain SS141 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |