Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118625
Name   oriT_plamid_3.1 in_silico
Organism   Klebsiella grimontii strain SS141
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP044530 (1..49 [-], 49 nt)
oriT length   49 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 49 nt

>oriT_plamid_3.1
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   19058 GenBank   NZ_CP044530
Plasmid name   plamid_3.1 Incompatibility group   -
Plasmid size   1491 bp Coordinate of oriT [Strand]   1..49 [-]
Host baterium   Klebsiella grimontii strain SS141

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -