Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118531 |
| Name | oriT_pDA33145-152  |
| Organism | Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029598 (146570..146619 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pDA33145-152
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18964 | GenBank | NZ_CP029598 |
| Plasmid name | pDA33145-152 | Incompatibility group | IncFIB |
| Plasmid size | 151998 bp | Coordinate of oriT [Strand] | 146570..146619 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | mrkA, mrkB, mrkC, mrkF, mrkJ |
| Metal resistance gene | arsH, arsR, arsB, arsC, fecE, fecD, silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsA, arsD, merR, merP, merC, merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |