Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118508
Name   oriT_ColJs in_silico
Organism   Shigella sonnei
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_002809 (4361..4420 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_ColJs
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18941 GenBank   NC_002809
Plasmid name   ColJs Incompatibility group   ColRNAI
Plasmid size   5210 bp Coordinate of oriT [Strand]   4361..4420 [-]
Host baterium   Shigella sonnei

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -