Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118497 |
| Name | oriT_6TM|p6TM-70  |
| Organism | Klebsiella variicola strain 6TM |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM008892 (38535..38584 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_6TM|p6TM-70
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18930 | GenBank | NZ_CM008892 |
| Plasmid name | 6TM|p6TM-70 | Incompatibility group | IncFIB |
| Plasmid size | 62069 bp | Coordinate of oriT [Strand] | 38535..38584 [+] |
| Host baterium | Klebsiella variicola strain 6TM |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | ncrA, ncrB, ncrC, ncrY |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |