Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118479
Name   oriT_FDAARGOS_429|unnamed in_silico
Organism   Raoultella planticola strain FDAARGOS_429
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP023873 (856..942 [-], 87 nt)
oriT length   87 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 87 nt

>oriT_FDAARGOS_429|unnamed
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18912 GenBank   NZ_CP023873
Plasmid name   FDAARGOS_429|unnamed Incompatibility group   -
Plasmid size   1173 bp Coordinate of oriT [Strand]   856..942 [-]
Host baterium   Raoultella planticola strain FDAARGOS_429

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -