Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118469 |
| Name | oriT_pKPN1481-3  |
| Organism | Klebsiella variicola strain KPN1481 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP020852 (1220..1268 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pKPN1481-3
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTTTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTTTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18902 | GenBank | NZ_CP020852 |
| Plasmid name | pKPN1481-3 | Incompatibility group | - |
| Plasmid size | 20380 bp | Coordinate of oriT [Strand] | 1220..1268 [+] |
| Host baterium | Klebsiella variicola strain KPN1481 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |