Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118366 |
| Name | oriT_J50|unnamed6  |
| Organism | Lactiplantibacillus plantarum strain J50 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP140094 (577..612 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 1..7, 17..23 (ACCCCAC..GTGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_J50|unnamed6
ACCCCACTAAATTTTGGTGGGGTGTAAGTGCGCATT
ACCCCACTAAATTTTGGTGGGGTGTAAGTGCGCATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18799 | GenBank | NZ_CP140094 |
| Plasmid name | J50|unnamed6 | Incompatibility group | - |
| Plasmid size | 6353 bp | Coordinate of oriT [Strand] | 577..612 [+] |
| Host baterium | Lactiplantibacillus plantarum strain J50 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |