Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118341
Name   oriT_UP_1395|unnamed in_silico
Organism   Staphylococcus aureus strain UP_1395
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP047821 (25151..25390 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 93..98, 110..115  (AAAAGC..GCTTTT)
 24..31, 44..51  (CTTTTTTA..TAAAAAAG)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_UP_1395|unnamed
AAGACATTAGTGATGACTGATGTCTTTTTTATTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACAGAGTTCTTAGAGATAAATTAAAAATTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18774 GenBank   NZ_CP047821
Plasmid name   UP_1395|unnamed Incompatibility group   -
Plasmid size   27406 bp Coordinate of oriT [Strand]   25151..25390 [-]
Host baterium   Staphylococcus aureus strain UP_1395

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21