Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118312 |
| Name | oriT_pSA93A  |
| Organism | Staphylococcus aureus strain 137/93A |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM004484 (1816..2005 [+], 190 nt) |
| oriT length | 190 nt |
| IRs (inverted repeats) | 133..139, 143..149 (GTCTGGC..GCCAGAC) 4..11, 23..30 (CTTTTTTA..TAAAAAAG) 16..21, 24..29 (TTTTTT..AAAAAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 190 nt
>oriT_pSA93A
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18745 | GenBank | NZ_CM004484 |
| Plasmid name | pSA93A | Incompatibility group | - |
| Plasmid size | 32184 bp | Coordinate of oriT [Strand] | 1816..2005 [+] |
| Host baterium | Staphylococcus aureus strain 137/93A |
Cargo genes
| Drug resistance gene | qacA, blaZ |
| Virulence gene | - |
| Metal resistance gene | cadC, merR, merT, merA, merB |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |