Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118307
Name   oriT_UP_996|unnamed1 in_silico
Organism   Staphylococcus aureus strain UP_996
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP047831 (18343..18582 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 37..42, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_UP_996|unnamed1
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTAGTTTTGTGACAAATACTGTATATAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18740 GenBank   NZ_CP047831
Plasmid name   UP_996|unnamed1 Incompatibility group   -
Plasmid size   25209 bp Coordinate of oriT [Strand]   18343..18582 [+]
Host baterium   Staphylococcus aureus strain UP_996

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21