Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118305 |
| Name | oriT_UP_883|unnamed  |
| Organism | Staphylococcus aureus strain UP_883 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP047836 (5216..5393 [+], 178 nt) |
| oriT length | 178 nt |
| IRs (inverted repeats) | 152..157, 167..172 (ATTTTA..TAAAAT) 106..112, 119..125 (TCCCCAT..ATGGGGA) 89..95, 99..105 (ATCTGGC..GCCAGAT) 21..28, 33..40 (GTGTCACA..TGTGACAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 178 nt
>oriT_UP_883|unnamed
TGTGACAAACGCAATATATTGTGTCACAAAACTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATTCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTGACAAACGCAATATATTGTGTCACAAAACTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATTCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18738 | GenBank | NZ_CP047836 |
| Plasmid name | UP_883|unnamed | Incompatibility group | - |
| Plasmid size | 17328 bp | Coordinate of oriT [Strand] | 5216..5393 [+] |
| Host baterium | Staphylococcus aureus strain UP_883 |
Cargo genes
| Drug resistance gene | blaZ |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |