Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118304 |
| Name | oriT_pFac90-54  |
| Organism | Enterococcus faecium strain fac90 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068246 (5256..5293 [+], 38 nt) |
| oriT length | 38 nt |
| IRs (inverted repeats) | 14..22, 29..37 (TAAAGTATA..TATACTTTA) 2..8, 13..19 (ACTTTAT..ATAAAGT) |
| Location of nic site | 27..28 |
| Conserved sequence flanking the nic site |
GTGTGTTATA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 38 nt
>oriT_pFac90-54
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
CACTTTATGAATATAAAGTATAGTGTGTTATACTTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18737 | GenBank | NZ_CP068246 |
| Plasmid name | pFac90-54 | Incompatibility group | - |
| Plasmid size | 54259 bp | Coordinate of oriT [Strand] | 5256..5293 [+] |
| Host baterium | Enterococcus faecium strain fac90 |
Cargo genes
| Drug resistance gene | tet(M), tet(L), fexB, poxtA, erm(B), vat(E), dfrG |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |