Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118299
Name   oriT_pSAHUG_S20a in_silico
Organism   Staphylococcus aureus strain MRSA_S20
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM003622 (14424..14616 [+], 193 nt)
oriT length   193 nt
IRs (inverted repeats)      167..172, 182..187  (ATTTTA..TAAAAT)
 99..106, 110..117  (TATCTGGC..GCCAGATA)
 55..62, 75..82  (GTCTTTTT..AAAAAGAC)
 33..39, 44..50  (TGTCACA..TGTGACA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 193 nt

>oriT_pSAHUG_S20a
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAACTGTGACATTTCGTCTTTTTATGCCCCCATGCAAAAAGACCGACGAAGTCTTGAAATATCTGGCTTTGCCAGATACCTCATCTATAGATGGGGTCATATTTCCCTTATGCTCTTACTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18732 GenBank   NZ_CM003622
Plasmid name   pSAHUG_S20a Incompatibility group   -
Plasmid size   16620 bp Coordinate of oriT [Strand]   14424..14616 [+]
Host baterium   Staphylococcus aureus strain MRSA_S20

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21