Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118287 |
| Name | oriT_FDAARGOS_1138|unnamed5  |
| Organism | Serratia plymuthica strain FDAARGOS_1138 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068101 (725..799 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | 12..17, 20..25 (GCCCTG..CAGGGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_FDAARGOS_1138|unnamed5
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGCAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18720 | GenBank | NZ_CP068101 |
| Plasmid name | FDAARGOS_1138|unnamed5 | Incompatibility group | ColRNAI |
| Plasmid size | 2581 bp | Coordinate of oriT [Strand] | 725..799 [-] |
| Host baterium | Serratia plymuthica strain FDAARGOS_1138 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |