Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118281 |
| Name | oriT_FDAARGOS_1139|unnamed3  |
| Organism | Shigella boydii strain FDAARGOS_1139 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP068093 (5347..5404 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_FDAARGOS_1139|unnamed3
GGGTTTCGGAGCGCAGCACTGAACCAGTCACGTAGCGCTAGCGGAGTGTACAGTGGCT
GGGTTTCGGAGCGCAGCACTGAACCAGTCACGTAGCGCTAGCGGAGTGTACAGTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18714 | GenBank | NZ_CP068093 |
| Plasmid name | FDAARGOS_1139|unnamed3 | Incompatibility group | ColRNAI |
| Plasmid size | 5519 bp | Coordinate of oriT [Strand] | 5347..5404 [+] |
| Host baterium | Shigella boydii strain FDAARGOS_1139 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |