Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118270 |
| Name | oriT_AC CHC|p3  |
| Organism | Klebsiella variicola strain AC CHC |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP066875 (14930..14978 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_AC CHC|p3
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18703 | GenBank | NZ_CP066875 |
| Plasmid name | AC CHC|p3 | Incompatibility group | IncFIA |
| Plasmid size | 57067 bp | Coordinate of oriT [Strand] | 14930..14978 [+] |
| Host baterium | Klebsiella variicola strain AC CHC |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |