Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118270
Name   oriT_AC CHC|p3 in_silico
Organism   Klebsiella variicola strain AC CHC
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP066875 (14930..14978 [+], 49 nt)
oriT length   49 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      32..33
Conserved sequence flanking the
  nic site  
 
 TGTGTGGTGA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 49 nt

>oriT_AC CHC|p3
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18703 GenBank   NZ_CP066875
Plasmid name   AC CHC|p3 Incompatibility group   IncFIA
Plasmid size   57067 bp Coordinate of oriT [Strand]   14930..14978 [+]
Host baterium   Klebsiella variicola strain AC CHC

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -