Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118269
Name   oriT_AC CHC|p10 in_silico
Organism   Klebsiella variicola strain AC CHC
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP066872 (9331..9388 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_AC CHC|p10
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGAAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18702 GenBank   NZ_CP066872
Plasmid name   AC CHC|p10 Incompatibility group   ColRNAI
Plasmid size   10712 bp Coordinate of oriT [Strand]   9331..9388 [-]
Host baterium   Klebsiella variicola strain AC CHC

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -