Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118266 |
| Name | oriT_pSTN0717-53-9 |
| Organism | Enterobacter kobei strain STN0717-53 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP022507 (961..1145 [+], 185 nt) |
| oriT length | 185 nt |
| IRs (inverted repeats) | 105..110, 115..120 (ACCCCC..GGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 185 nt
>oriT_pSTN0717-53-9
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCCTCTTTTGGGGTGGAACAACAAGGCATTTTAGGGGTGAAGCGAAGAGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCCTCTTTTGGGGTGGAACAACAAGGCATTTTAGGGGTGAAGCGAAGAGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18699 | GenBank | NZ_AP022507 |
| Plasmid name | pSTN0717-53-9 | Incompatibility group | Col |
| Plasmid size | 2353 bp | Coordinate of oriT [Strand] | 961..1145 [+] |
| Host baterium | Enterobacter kobei strain STN0717-53 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |