Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118120
Name   oriT_pOSUMEAT4 in_silico
Organism   Raoultella ornithinolytica strain OHMEATKPC2_NDM5
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054274 (2254..2303 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      5..12, 15..22  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_pOSUMEAT4
ATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18553 GenBank   NZ_CP054274
Plasmid name   pOSUMEAT4 Incompatibility group   Col440I
Plasmid size   3271 bp Coordinate of oriT [Strand]   2254..2303 [+]
Host baterium   Raoultella ornithinolytica strain OHMEATKPC2_NDM5

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -