Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 118097 |
| Name | oriT_pSA-022  |
| Organism | Staphylococcus aureus strain SA-022 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CM003169 (6315..6499 [+], 185 nt) |
| oriT length | 185 nt |
| IRs (inverted repeats) | 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 185 nt
>oriT_pSA-022
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGACCTCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTGAAATTT
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGACCTCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTGAAATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18530 | GenBank | NZ_CM003169 |
| Plasmid name | pSA-022 | Incompatibility group | - |
| Plasmid size | 15134 bp | Coordinate of oriT [Strand] | 6315..6499 [+] |
| Host baterium | Staphylococcus aureus strain SA-022 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | mco |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |