Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118068
Name   oriT_pDSM799 in_silico
Organism   Staphylococcus aureus strain DSM 799
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CM003167 (17681..17865 [+], 185 nt)
oriT length   185 nt
IRs (inverted repeats)      118..123, 130..135  (CCCCAT..ATGGGG)
 100..106, 110..116  (ATCTGGC..GCCAGAT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 185 nt

>oriT_pDSM799
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGACCTCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGTTTTTAGAGAAAAATTGAAATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18501 GenBank   NZ_CM003167
Plasmid name   pDSM799 Incompatibility group   -
Plasmid size   27013 bp Coordinate of oriT [Strand]   17681..17865 [+]
Host baterium   Staphylococcus aureus strain DSM 799

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsB, arsC, mco
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21