Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118055
Name   oriT_pC82067_4_2k in_silico
Organism   Klebsiella aerogenes strain C82067
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP139386 (195..252 [-], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pC82067_4_2k
GGGTGTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18488 GenBank   NZ_CP139386
Plasmid name   pC82067_4_2k Incompatibility group   ColRNAI
Plasmid size   2746 bp Coordinate of oriT [Strand]   195..252 [-]
Host baterium   Klebsiella aerogenes strain C82067

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -