Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118039
Name   oriT_pZ172_1 in_silico
Organism   Staphylococcus aureus subsp. aureus Z172
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_022610 (6854..7092 [-], 239 nt)
oriT length   239 nt
IRs (inverted repeats)      170..177, 182..189  (CTATCATT..AATGATAG)
 153..159, 163..169  (GTCTGGC..GCCAGAC)
 24..31, 43..50  (CTTTTTTA..TAAAAAAG)
 36..41, 44..49  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 239 nt

>oriT_pZ172_1
AAGACATTAGTGATGACTGATGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTACGGAGTTCTTAGAGAAAAATTAAAAATTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18472 GenBank   NC_022610
Plasmid name   pZ172_1 Incompatibility group   -
Plasmid size   27326 bp Coordinate of oriT [Strand]   6854..7092 [-]
Host baterium   Staphylococcus aureus subsp. aureus Z172

Cargo genes


Drug resistance gene   qacA
Virulence gene   -
Metal resistance gene   merB, merA, merT, merR, cadC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21