Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118032
Name   oriT_TSDC17.2-1.1|78 in_silico
Organism   Parabacteroides distasonis strain Parabacteroides distasonis TSDC17.2-1.1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_OY725823 (149764..149988 [-], 225 nt)
oriT length   225 nt
IRs (inverted repeats)      182..187, 201..206  (AACTAC..GTAGTT)
 167..173, 178..184  (GTTATAG..CTATAAC)
 143..149, 162..168  (ACCGAAA..TTTCGGT)
 2..7, 11..16  (CCGTAT..ATACGG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 225 nt

>oriT_TSDC17.2-1.1|78
TCCGTATGGAATACGGCAGGGACTTATATATCCGTGATGCTTCGCAGACCTACAGCGGATGCAAGGATTTGAACGAATACTTACAGAAACAGACTGAAAGAAACAGGCAAGTCCGGTCTGCAAAGGAAACGCACAGCCGACCACCGAAAAAGAAAAACGGCTTTCGGTTATAGCCCACTATAACTACACGCTTCGCTTTCGTAGTTGTGGGCTCTCCCGAGGGGA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18465 GenBank   NZ_OY725823
Plasmid name   TSDC17.2-1.1|78 Incompatibility group   -
Plasmid size   237076 bp Coordinate of oriT [Strand]   149764..149988 [-]
Host baterium   Parabacteroides distasonis strain Parabacteroides distasonis TSDC17.2-1.1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA11