Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   118025
Name   oriT_FDAARGOS_700|unnamed1 in_silico
Organism   Bacillus anthracis strain FDAARGOS_700
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP047100 (374..433 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FDAARGOS_700|unnamed1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18458 GenBank   NZ_CP047100
Plasmid name   FDAARGOS_700|unnamed1 Incompatibility group   ColRNAI
Plasmid size   1988 bp Coordinate of oriT [Strand]   374..433 [+]
Host baterium   Bacillus anthracis strain FDAARGOS_700

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -