Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117999
Name   oriT_p3-S2-IND-01-C in_silico
Organism   Klebsiella electrica strain S2-IND-01-C
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP112890 (41..90 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      5..12, 15..22  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_p3-S2-IND-01-C
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18432 GenBank   NZ_CP112890
Plasmid name   p3-S2-IND-01-C Incompatibility group   Col440I
Plasmid size   3961 bp Coordinate of oriT [Strand]   41..90 [+]
Host baterium   Klebsiella electrica strain S2-IND-01-C

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -