Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 117999
• Name: oriT_p3-S2-IND-01-C
• Organism: Klebsiella electrica strain S2-IND-01-C
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP112890 (41..90 [+], 50 nt)
• oriT length: 50 nt
• IRs (inverted repeats): 5..12, 15..22 (GCAAAATT..AATTTTGC)
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 50 nt

>oriT_p3-S2-IND-01-C
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 18432
• GenBank: NZ_CP112890
• Plasmid name: p3-S2-IND-01-C
• Incompatibility group: Col440I
• Plasmid size: 3961 bp
• Coordinate of oriT [Strand]: 41..90 [+]
• Host baterium: Klebsiella electrica strain S2-IND-01-C

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -