Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117997 |
| Name | oriT_unnamed3  |
| Organism | Klebsiella electrica strain DSM 102253 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP041250 (52634..52682 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_unnamed3
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 38802..53240
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| Electrica_RS27755 (electrica_05566) | 36188..36457 | + | 270 | WP_023280901 | hypothetical protein | - |
| Electrica_RS27760 (electrica_05567) | 36472..36810 | + | 339 | WP_023280902 | hypothetical protein | - |
| Electrica_RS27765 (electrica_05569) | 37001..37444 | - | 444 | WP_074186234 | helix-turn-helix domain-containing protein | - |
| Electrica_RS27770 (electrica_05570) | 37649..38352 | - | 704 | Protein_36 | IS6-like element IS26 family transposase | - |
| Electrica_RS27775 (electrica_05571) | 38389..38802 | - | 414 | WP_142255982 | type-F conjugative transfer system protein TrbI | - |
| Electrica_RS27780 (electrica_05572) | 38802..41441 | - | 2640 | WP_142255983 | type IV secretion system protein TraC | virb4 |
| Electrica_RS27785 (electrica_05573) | 41513..41911 | - | 399 | WP_014343490 | hypothetical protein | - |
| Electrica_RS27795 (electrica_05574) | 42287..42691 | - | 405 | WP_004197817 | hypothetical protein | - |
| Electrica_RS27800 (electrica_05575) | 42758..43069 | - | 312 | WP_142255984 | hypothetical protein | - |
| Electrica_RS27805 (electrica_05576) | 43070..43288 | - | 219 | WP_014386199 | hypothetical protein | - |
| Electrica_RS29100 | 43312..43560 | - | 249 | WP_223175793 | hypothetical protein | - |
| Electrica_RS29105 | 43631..44029 | - | 399 | WP_020277946 | hypothetical protein | - |
| Electrica_RS27820 (electrica_05577) | 44184..44768 | - | 585 | WP_020277945 | type IV conjugative transfer system lipoprotein TraV | traV |
| Electrica_RS27825 (electrica_05578) | 44842..46266 | - | 1425 | WP_142255985 | F-type conjugal transfer pilus assembly protein TraB | traB |
| Electrica_RS27830 (electrica_05579) | 46266..47006 | - | 741 | WP_048235042 | type-F conjugative transfer system secretin TraK | traK |
| Electrica_RS27835 (electrica_05580) | 46993..47559 | - | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| Electrica_RS27840 (electrica_05581) | 47579..47884 | - | 306 | WP_142255986 | type IV conjugative transfer system protein TraL | traL |
| Electrica_RS27845 (electrica_05582) | 47898..48104 | - | 207 | Protein_50 | type IV conjugative transfer system pilin TraA | - |
| Electrica_RS27850 (electrica_05583) | 48254..49201 | - | 948 | WP_019706001 | IS30-like element ISAs2 family transposase | - |
| Electrica_RS27855 (electrica_05584) | 49328..50455 | + | 1128 | WP_041204928 | ISAs1-like element ISKpn9 family transposase | - |
| Electrica_RS27860 (electrica_05585) | 50476..50646 | - | 171 | Protein_53 | type IV conjugative transfer system pilin TraA | - |
| Electrica_RS27865 | 50714..50914 | - | 201 | WP_046664192 | TraY domain-containing protein | - |
| Electrica_RS27870 (electrica_05586) | 51000..51701 | - | 702 | WP_025712700 | hypothetical protein | - |
| Electrica_RS27875 (electrica_05587) | 51931..52323 | - | 393 | WP_004194114 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| Electrica_RS27880 (electrica_05588) | 52755..53240 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| Electrica_RS27885 | 53273..53602 | - | 330 | WP_011977736 | DUF5983 family protein | - |
| Electrica_RS27890 (electrica_05589) | 53635..54456 | - | 822 | WP_004182076 | DUF932 domain-containing protein | - |
| Electrica_RS27900 (electrica_05590) | 54809..55834 | + | 1026 | WP_001101446 | IS110 family transposase | - |
| Electrica_RS27905 (electrica_05591) | 56129..57097 | + | 969 | WP_167686292 | IS5 family transposase | - |
Host bacterium
| ID | 18430 | GenBank | NZ_CP041250 |
| Plasmid name | unnamed3 | Incompatibility group | - |
| Plasmid size | 83988 bp | Coordinate of oriT [Strand] | 52634..52682 [+] |
| Host baterium | Klebsiella electrica strain DSM 102253 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |