Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117977
Name   oriT_FDAARGOS_1334|unnamed14 in_silico
Organism   Klebsiella oxytoca strain FDAARGOS_1334
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP069914 (3387..3446 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FDAARGOS_1334|unnamed14
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18410 GenBank   NZ_CP069914
Plasmid name   FDAARGOS_1334|unnamed14 Incompatibility group   ColRNAI
Plasmid size   5631 bp Coordinate of oriT [Strand]   3387..3446 [+]
Host baterium   Klebsiella oxytoca strain FDAARGOS_1334

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -