Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117976 |
| Name | oriT_FDAARGOS_1334|unnamed19  |
| Organism | Klebsiella oxytoca strain FDAARGOS_1334 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP069913 (626..675 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_FDAARGOS_1334|unnamed19
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18409 | GenBank | NZ_CP069913 |
| Plasmid name | FDAARGOS_1334|unnamed19 | Incompatibility group | Col440I |
| Plasmid size | 4420 bp | Coordinate of oriT [Strand] | 626..675 [+] |
| Host baterium | Klebsiella oxytoca strain FDAARGOS_1334 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |