Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 117940 |
Name | oriT_pHH15_2 |
Organism | Raoultella planticola strain HH15 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP069817 (3141..3200 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pHH15_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 18373 | GenBank | NZ_CP069817 |
Plasmid name | pHH15_2 | Incompatibility group | Col440II |
Plasmid size | 5665 bp | Coordinate of oriT [Strand] | 3141..3200 [+] |
Host baterium | Raoultella planticola strain HH15 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |