Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117940
Name   oriT_pHH15_2 in_silico
Organism   Raoultella planticola strain HH15
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP069817 (3141..3200 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pHH15_2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18373 GenBank   NZ_CP069817
Plasmid name   pHH15_2 Incompatibility group   Col440II
Plasmid size   5665 bp Coordinate of oriT [Strand]   3141..3200 [+]
Host baterium   Raoultella planticola strain HH15

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -