Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117932
Name   oriT_SWMUF35|pB in_silico
Organism   Klebsiella quasipneumoniae strain SWMUF35
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP068446 (65605..65703 [+], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_SWMUF35|pB
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18365 GenBank   NZ_CP068446
Plasmid name   SWMUF35|pB Incompatibility group   IncR
Plasmid size   90038 bp Coordinate of oriT [Strand]   65605..65703 [+]
Host baterium   Klebsiella quasipneumoniae strain SWMUF35

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   merE, merD, merA, merF, merP, merT, merR2
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -