Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117899
Name   oriT_pSFxv_3 in_silico
Organism   Shigella flexneri 2002017
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NC_017329 (714..773 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pSFxv_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18332 GenBank   NC_017329
Plasmid name   pSFxv_3 Incompatibility group   ColRNAI
Plasmid size   6200 bp Coordinate of oriT [Strand]   714..773 [-]
Host baterium   Shigella flexneri 2002017

Cargo genes


Drug resistance gene   aph(6)-Id, aph(3'')-Ib, sul2
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -