Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117881 |
| Name | oriT_pKOCBH-D  |
| Organism | Klebsiella michiganensis strain M82255 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP035218 (2038..2097 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pKOCBH-D
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18314 | GenBank | NZ_CP035218 |
| Plasmid name | pKOCBH-D | Incompatibility group | Col440I |
| Plasmid size | 8852 bp | Coordinate of oriT [Strand] | 2038..2097 [-] |
| Host baterium | Klebsiella michiganensis strain M82255 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |