Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117877 |
| Name | oriT_pCAV2018-177 |
| Organism | Klebsiella quasipneumoniae strain CAV2018 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029430 (60859..60906 [-], 48 nt) |
| oriT length | 48 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | 31..32 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 48 nt
>oriT_pCAV2018-177
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18310 | GenBank | NZ_CP029430 |
| Plasmid name | pCAV2018-177 | Incompatibility group | IncFIB |
| Plasmid size | 177029 bp | Coordinate of oriT [Strand] | 60859..60906 [-] |
| Host baterium | Klebsiella quasipneumoniae strain CAV2018 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | fecD, fecE, nirD, ncrC, ncrB, ncrA, arsD, arsR, pcoE, pcoS, pcoR, pcoD, pcoC, pcoB, pcoA, silP, silA, silB, silF, silC, silR, silS, silE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |