Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117866 |
| Name | oriT_pCAV1947-173  |
| Organism | Klebsiella quasipneumoniae strain CAV1947 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029441 (49609..49656 [-], 48 nt) |
| oriT length | 48 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | 31..32 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 48 nt
>oriT_pCAV1947-173
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18299 | GenBank | NZ_CP029441 |
| Plasmid name | pCAV1947-173 | Incompatibility group | IncFIB |
| Plasmid size | 172839 bp | Coordinate of oriT [Strand] | 49609..49656 [-] |
| Host baterium | Klebsiella quasipneumoniae strain CAV1947 |
Cargo genes
| Drug resistance gene | dfrA14 |
| Virulence gene | - |
| Metal resistance gene | silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsR, arsD, merE, merD, merA, merC, merP, merT, merR, ncrA, ncrB, ncrC, nirD, fecE, fecD, silE, silS |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |