Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117865
Name   oriT_pKPC_CAV1947-14 in_silico
Organism   Klebsiella quasipneumoniae strain CAV1947
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP029438 (14033..14092 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pKPC_CAV1947-14
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18298 GenBank   NZ_CP029438
Plasmid name   pKPC_CAV1947-14 Incompatibility group   Col440II
Plasmid size   14106 bp Coordinate of oriT [Strand]   14033..14092 [-]
Host baterium   Klebsiella quasipneumoniae strain CAV1947

Cargo genes


Drug resistance gene   blaKPC-3
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -