Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 117846 |
Name | oriT_RN6390|unnamed |
Organism | Staphylococcus aureus strain RN6390 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP090002 (1330..1389 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_RN6390|unnamed
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 18279 | GenBank | NZ_CP090002 |
Plasmid name | RN6390|unnamed | Incompatibility group | Col |
Plasmid size | 1822 bp | Coordinate of oriT [Strand] | 1330..1389 [+] |
Host baterium | Staphylococcus aureus strain RN6390 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |