Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117807
Name   oriT_pXM9F202-2-tetX-90k in_silico
Organism   Acinetobacter variabilis strain XM9F202-2
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP060813 (56733..56836 [-], 104 nt)
oriT length   104 nt
IRs (inverted repeats)      63..70, 73..80  (CACCATGC..GCATGGTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 104 nt

>oriT_pXM9F202-2-tetX-90k
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18240 GenBank   NZ_CP060813
Plasmid name   pXM9F202-2-tetX-90k Incompatibility group   -
Plasmid size   90430 bp Coordinate of oriT [Strand]   56733..56836 [-]
Host baterium   Acinetobacter variabilis strain XM9F202-2

Cargo genes


Drug resistance gene   lnu(G), floR, aph(3'')-Ib, aph(6)-Id, sul2, tet(X3), dfrA1, ant(3'')-Ia, aph(3')-Ia, aac(3)-IIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -