Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 117807 |
Name | oriT_pXM9F202-2-tetX-90k |
Organism | Acinetobacter variabilis strain XM9F202-2 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP060813 (56733..56836 [-], 104 nt) |
oriT length | 104 nt |
IRs (inverted repeats) | 63..70, 73..80 (CACCATGC..GCATGGTG) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 104 nt
>oriT_pXM9F202-2-tetX-90k
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG
GCCCCGCAGGGCAGGATTCCCGTTGAGCGCCGCAGGTGCGAATAAGGGGAAGTGAAGAGGAACACCATGCTTGCATGGTGGGCCTACTTCACACATCCTGCCCG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 18240 | GenBank | NZ_CP060813 |
Plasmid name | pXM9F202-2-tetX-90k | Incompatibility group | - |
Plasmid size | 90430 bp | Coordinate of oriT [Strand] | 56733..56836 [-] |
Host baterium | Acinetobacter variabilis strain XM9F202-2 |
Cargo genes
Drug resistance gene | lnu(G), floR, aph(3'')-Ib, aph(6)-Id, sul2, tet(X3), dfrA1, ant(3'')-Ia, aph(3')-Ia, aac(3)-IIa |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |