Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 117798 |
| Name | oriT_KqPF26|p2  |
| Organism | Klebsiella quasipneumoniae strain KqPF26 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP065840 (47..95 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_KqPF26|p2
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGA
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 18231 | GenBank | NZ_CP065840 |
| Plasmid name | KqPF26|p2 | Incompatibility group | ColRNAI |
| Plasmid size | 3478 bp | Coordinate of oriT [Strand] | 47..95 [+] |
| Host baterium | Klebsiella quasipneumoniae strain KqPF26 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |