Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   117774
Name   oriT_KqPF9|p2 in_silico
Organism   Klebsiella quasipneumoniae strain KqPF9
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP065843 (4323..4373 [+], 51 nt)
oriT length   51 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_KqPF9|p2
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   18207 GenBank   NZ_CP065843
Plasmid name   KqPF9|p2 Incompatibility group   Col440I
Plasmid size   4730 bp Coordinate of oriT [Strand]   4323..4373 [+]
Host baterium   Klebsiella quasipneumoniae strain KqPF9

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -